Я могу использовать мои часы на пинг мой телефон, но как я могу использовать мой телефон для пинг-мои часы

Почему анимация лагает и тормозит на моем ноутбуке? АМД Турион Тл-56 и HD 3200 с 2 гига ОЗУ.

+143
NAS TIA 26 сент. 2012 г., 13:50:37
21 ответов

У меня есть файл fasta, где последовательности расстался со строками. Я хочу, чтобы удалить символ новой строки. Вот пример моего файла:

>accession1
ATGGCCCATG
GGATCCTAGC
>accession2
GATATCCATG
AAACGGCTTA

Я бы хотел, чтобы преобразовать его в этом:

>ATGGCCCATGGGATCCTAGC accession1 
>accession2 GATATCCATGAAACGGCTTA

мне нужен второй файл, который содержит две колонки. Число вступлении в первый, затем во второй последовательности.

+964
user45596 03 февр. '09 в 4:24

[ ... -нэ ... ] - тест на неравенство
$(( ... + 1)) - добавить один, арифметика расширение
${массив[$я]} - ссылка на элемент из массива переменной

Или другими словами испытание на[Я] + 1 != А[я + 1]

+912
silence 29 авг. 2018 г., 15:55:19

прежде всего я хочу сказать, что мой вопрос не о 'Portfwd' вариант meterpreter: https://www.offensive-security.com/metasploit-unleashed/portfwd/

Допустим, у меня есть доступ к 2 компьютерам:
- Компьютер-мой и работает на Linux.
- Компьютер-это взломанный узел и тоже под управлением Linux.
- Компьютер с одним я хочу компромисс.


Я использование Metasploit Framework для этой цели. Как я могу добиться установления обратной связи TCP с C до B и затем подключить от A к B, чтобы захватить meterpreter сессия ? Дело в том, что я не хочу, что б знать IP-адрес в любой точке. Поэтому это будет иметь для начала соединения (с помощью proxychains или любой другой программой для скрытия своего реального IP).

Сначала я попытался воспроизвести эту проблему, используя для netcat, но, возможно, я чего-то недопонимаю тут:
- Компьютер работает под управлением netcat на сервер на порт 4444: НК -л -п 4444 (потому что будет работать meterpreter сервера).
- Компьютер с подключение к B на порт 8888 НК 'Б' 8888 (потому что будет выполнять полезную нагрузку и подключится к удаленном сервере, поэтому она не имеет никакой связи с моим реальным IP)
- Компьютер придется установить netcat на слушателя на порту 8888, чтобы принимать TCP-соединения с C (я не уверен насчет этого)


Теперь мой вопрос: как я могу получить связь между Б и без Б, зная IP-адрес А.

Я пытался использовать SSH, чтобы сделать местные переадресации порта от A до B:
torify СШ-НЛ 4444:имя localhost:8888 Б , но она мне говорит, что порт 4444 уже используется (НЦ слушателя в)
Я нарисовал простую схему так, может быть, это будет более понятно, схема то, что хотелось бы иметь: port fowarding

+891
Smovies 14 дек. 2018 г., 03:00:09

Я бы не использовать команду grep. Вместо этого я бы сравнил именем, используя встроенный тест оператора ([[..]]), которые могут обрабатывать регулярные выражения непосредственно.

функцией getname(){
 местное имени="$1"

 [[ -з "$имени" ]] && прочитать -п "введите имя файла:" имени

 пока [[ "$имени" =~ ^[[:Альфа:]] ]] && [[ -Ф "$имени" ]]
делать
 [[ -д $имени ]] && Эхо "пути не юридическое имя файла".

 читать -п "введите имя файла:" имени
сделано
}
+883
Greg Bowyer 15 окт. 2022 г., 10:26:31

У меня машина для архитектуры MIPSEL запущена на эмуляторе QEMU. Для того, чтобы активировать сеть в моем QEMU для архитектуры MIPSEL машина, я использую мост virbr0.

Во-первых, я создаю интерфейс tap0 и довести его до. Я делаю это следующим образом :-

судо tunctl -Т tap0 && судо команду ifconfig tap0 вверх

Далее я добавляю tap0 и интерфейс, который приносит в интернет соединение(в данном случае на eth1) к мосту.

команду sudo brctl addif virbr0 tap0

команду sudo brctl addif virbr0 на eth1

Наконец, я начинаю мой в QEMU машины с флагами -нет Ник-продажи крана,ifname=tap0,скрипта=нет,downscript=нет.

На данный момент пару вещей случится.

  1. Я не в состоянии получить доступ к интернету от моего в QEMU пом машина. Это, кажется, быть в состоянии пинговать virbr0 и на eth1с IP-адреса, однако, он не может получить доступ к интернету.
  2. Второй я добавляю на eth1 интерфейс virbr0 мой хозяин теряет возможность подключиться к интернету. Он способен подключаться к интернету, только если я удалить eth1 и от virbr0.

Как я могу решить [1] и/или [2]?

Спасибо!

+778
Nermeen 23 авг. 2023 г., 20:35:15

В итоге я дала им два варианта на мое "начало" страница. Я кратко объясню, что скрипт установки, например, ищет ~/.местные/bin или тому подобное, а затем, возможно, добавив, что на пути в ~/.zshrc или ~/.bashrc следующее. Я также дать им возможность установки вручную, вместо того, чтобы использовать скрипт, с простым инструкциям, чтобы сделать это.

Для запуска автоматической установки пользователь может вставить и выполнить команду:

завиток -с https://thesite.com/installmycmd > в /tmp/инст; источник /tmp/и инст

Это сценарий installmycmd:

#!/бин/Баш

База="https://thesite.com"

объявить-binddirs
bindirs=(домой$/ОГРН $дома/.местные/Бен $дома/.бин)

founddir="ложь"

findprofile() {
 профили=($дома/.zshrc $дома/.bashrc и $дома/.bash_login все в $Home/.вход $дома/.профиль)
 для проф в "${профилей[@]}"; сделать
 если [ -Ф "$проф" ]; затем
 Эхо "$проф"
вернуться
интернет
сделано
 касания $дома/.профиль
 Эхо "$дома/.профиль"
}

для переменные bindir в "${bindirs[@]}"; сделать
 если [ -д "$и bindir" ]; затем
founddir=истина
 Эхо "у Вас пользователей Бин здесь Дира $и bindir".
whichprofile=$(findprofile)
 pathline=$(грэп ^путь= $whichprofile)
 если [[ ! $pathline == *$переменные bindir* ]]; затем
 Эхо "добавляя $и bindir на пути в $whichprofile"
 Эхе -е "\nexport путь=\в$Path:$переменные bindir" >> "$whichprofile"
 Значение newpath=пути$Path:$переменные bindir 
 экспорт newpath не
еще
 эхо ", которое на своем пути в $whichprofile"
интернет
перерыв;
интернет
сделано

если [ ! -з $newpath не ]; тогда
 Эхо "экспортировать путь: $newpath не" 
 экспорт путь=$newpath не
интернет

если [[ "$founddir" == "ложный" ]]; затем
 эхо "не удалось найти ~/.bin или ~/.местные/bin или ~/БИН".
 Эхо "создание ~/.местные/bin и добавив к пути"

 команды mkdir -Р $дома/.местные/Бен
переменные bindir=$дома/.местные/Бен

whichprofile=$(findprofile)
 Эхо "добавляя путь отредактируйте до $whichprofile"

 Эхо -э "путь\nexport=$path: в файле$Home/.местные/Бен" >> "$whichprofile"
 экспортировать переменную PATH=$PATH: в файле$Home/.местные/Бен
интернет

Баш-с", завиток -с $BASE/JSON.sh > $bindir/JSON.sh"
Баш-с "керл -с $База/mycmd > $переменные bindir/mycmd"
чмод УГ+х $и bindir/mycmd
чмод УГ+х $bindir/JSON.sh
+747
socially awkward people 12 июн. 2018 г., 12:43:28

Я установил Андроид Киндл приложения и купленные моей первой электронной книгой Kindle вчера.

Хотя у меня есть аккаунт на Амазоне.ко.Великобритания и использовал данный аккаунт для нескольких покупок DVD и обычные книги, я не могу купить Kindle для чтения электронных книг с этого сайта.

Однако я могу купить Kindle для чтения электронных книг amazon.com (с таким же логином).

Кто-нибудь знает почему это ?

+741
arturjan1985 5 сент. 2014 г., 12:20:50

У меня AlphaRev кислорода Р2, 4Ext Recovery сенсорный, АН-дроид 2.2.0 с Android 2.3.3 на моем HTC желание. Но у меня есть только 304 МБ доступной внутренней памяти после первой загрузки. Теперь я установил Shazam и он сократился до 296 МБ.

Не должно ли это количество остаются теми же, когда я установить приложение? Я имею в виду я отформатировал свою SD карту в 4Ext и создал 2 ГБ раздел ext4 для приложений. Приложение быть в любом случае установлены на внутреннюю память? Как я могу проверить, что? И если это так, как я скажу это на SD-доб, а не раздел?

Этот диск должен прийти с интегрированным с app2sd+. Разве не так? Если нет, можете ли вы предложить другой диск, который интегрирован с app2sd+ или подскажите как настроить его вручную?

304 MB available

Я хочу, чтобы память, мужчины!! Этот тупой телефон поставляется только с 147 МБ памяти, доступной для приложений и данных пользователей. Я не знаю, какого черта они думали, когда проектировали его.

В ответ на Изя

Это выход из Маунт команду.

ш-3.2# горы
гора
файловой системы / корневой ФС в режиме RW,режиме 0 0
файловая система tmpfs в /dev файловой системе tmpfs RW,в режиме,режиме=755 0 0
devpts /dev и оч devpts RW,в режиме,режиме=600 0 0
прок /тез Докл RW,в режиме 0 0
файловой системы sysfs /sys файла файловой системы sysfs RW,в режиме 0 0
/системы/ядра/отладки /системы/ядра/отладки активные RW,в режиме 0 0
ни одно /счет контрольной группе РВ,режиме,подсистема cpuacct 0 0
файловая система tmpfs /шоссе/ASEC файловая система tmpfs RW,в режиме,режиме=755,с gid=1000 0 0
файловая система tmpfs в /MNT/кэш файловой системе tmpfs RW,в режиме,режиме=755,с gid=1000 0 0
файловая система tmpfs /приложение-кэш файловой системе tmpfs RW,в режиме,размер=8192k,режим=755,с gid=1000 0 0
нет устройства /dev/cpuctl контрольной группы РВ,параметром ЦП 0 0
в /dev/блок/mtdblock3 /системы yaffs2 RW,в режиме 0 0
в /dev/блок/mtdblock4 /кэш yaffs2 РАО,с nosuid,nodev,режиме 0 0
в /dev/блок/mtdblock5 /система/сведения yaffs2 РАО,с nosuid,nodev,существует два метода,nodiratime 0 0
в /dev/блок/mmcblk0p2 /данных в ext4 RW,то с nosuid,nodev,существует два метода,nodiratime,совершающих=50,бар
Риер=0,nobh,нашивки=64 данные=запись,noauto_da_alloc 0 0
на /dev/блок/Волд/179:1 /шоссе/sdcard и vfat RW,то помощью dirsync,с nosuid,nodev,с параметром noexec,режиме,у
ИД=1000,gid=, что 1015,fmask=0702,разделах=0702,allow_utime=0020,аргумент codepage=cp437,iocharset
=набор символов iso8859-1,короткое имя=смешанное,UTF-8,то ошибки=перемонтировать-РО 0 0
устройство /dev/блок/Волд/179:1 в /MNT/надежности/АСЕК и vfat RW,то помощью dirsync,с nosuid,nodev,с параметром noexec,релат
име,номер uid=1000,gid=, что 1015,fmask=0702,разделах=0702,allow_utime=0020,аргумент codepage=cp437,ioch
арсет=набор символов iso8859-1,короткое имя=смешанное,UTF-8,то ошибки=перемонтировать-РО 0 0
файловая система tmpfs /шоссе/sdcard/.android_secure файловая система tmpfs РО,режиме,размер=0К,режим=000 0 0
в /dev/блок/ДМ-0 /шоссе/ASEC/СЭ.fmckl.regnr-1 и vfat РО,как dirsync,с nosuid,nodev,режиме
,с uid=1000,fmask=0222,разделах=0222,аргумент codepage=cp437,iocharset=набор символов iso8859-1,короткое имя=смешать
Эд,как utf8,ошибки=перемонтировать-РО 0 0
в /dev/блок/СД-1 /шоссе/ASEC/ком.fingersoft.benjibananas-2 и vfat РО,как dirsync,с nosuid,Н
odev,режиме,него uid=1000,fmask=0222,разделах=0222,аргумент codepage=cp437,iocharset=кодировка iso8859-1,
короткое имя=смешанное,кодировке utf8,ошибки=перемонтировать-РО 0 0
ш-3.2#

Выход ДФ команды.

ш-3.2# ДФ
ДФ
/разработки: 207168K общее, 64К используются, 207104K доступен (размер блока 4096)
/шоссе/ASEC: 207168K общее, 0К используется, 207168K доступен (размер блока 4096)
каталог /mnt/кэш: 207168K общее, 0К используется, 207168K доступен (размер блока 4096)
/приложение-кэш: 8192K общее, 0К используется, 8192K доступен (размер блока 4096)
/системы: 256000K общее, 213132K используется, 42868K доступен (размер блока 4096)
/кэш-память: 40960K общее, 1388K используется, 39572K доступен (размер блока 4096)
/системы/данных: 151168K общее, 113812K используется, 37356K доступен (размер блока 4096)
/данных: 2064144K общее, 444856K используется, 1619288K доступен (размер блока 4096)
/шоссе/sdcard: 28544368K общее, 9550336K используется, 18994032K доступен (размер блока 163
84)
каталог /mnt/безопасной/АСЕК: 28544368K общее, 9550336K используется, 18994032K доступен (блок СИЗ
е 16384)
/шоссе/ASEC/СЭ.fmckl.regnr-1: 3124K общей сложности 1040K используется, 2084K доступен (размер блока 
4096)
/шоссе/ASEC/ком.fingersoft.benjibananas-2: 33212K общее, 30996K используется, 2216K пок
Бле (размер блока 4096)
ш-3.2#

Ты видишь в этом смысл?

+555
David Heidrich 5 дек. 2021 г., 15:51:34

Есть много учебников для апача , как это сделать. Это один из них.

Вот еще один

Одна вещь, которую вы хотели изменить, если у вас уже есть сгенерированный сертификат необходимо скопировать файлы с сертификатами на соответствующие места и создавая их сами.

Если вы не используете Апач , пожалуйста, разместить веб-сервер вы используете.

+554
fibono 18 янв. 2013 г., 22:52:34

Обращаясь к функции CAmount CFeeRate::GetFee(size_t в nBytes_) в feerate.cpp:

Если я пройду, скажем, 2000 как то nbytes аргумент, что эта функция возвращает в качестве платы nFee? Я не понимаю, как nSatoshisPerK определяется. Кроме того, любопытно, почему это используется вместо того, чтобы позволить шахтерам определить этот сбор за счет селективной добычи.

CAmount CFeeRate::GetFee(size_t в nBytes_) константный
{
 утверждаю(nBytes_ <= uint64_t(с std::numeric_limits<int64_t>::Макс()));
 int64_t nSize = int64_t(nBytes_);

 CAmount nFee = nSatoshisPerK * nSize / 1000;

 если (nFee == 0 && nSize != 0) {
 если (nSatoshisPerK > 0)
 nFee = CAmount(1);
 если (nSatoshisPerK < 0)
 nFee = CAmount(-1);
}

 возвращение nFee;
}
+529
eugenijusr 14 апр. 2011 г., 21:27:59

"Почему это происходит?" - довольно легко ответить. Представьте, у вас есть коридор, который вы можете поместиться четыре человека вниз, бок о бок. Вы хотите переместить весь мусор в один конец, в другой конец. Наиболее эффективное количество-4 человека.

Если у вас есть 1-3 человека, то ты пропускаешь через некоторое пространство коридора. Если у вас есть 5 или более человек, то, по крайней мере один из тех людей, в основном, застрял в очереди за другого человека все время. Добавляя все больше и больше людей просто забивает коридоре, он не ускоряет деятельность.

Так вы хотите иметь столько людей, сколько вы можете вписаться, не вызывая никаких очередей. Почему у вас очереди (или трудности) зависит от вопросов в ОДС ответ.

+473
OS XIII 27 июн. 2019 г., 09:47:51

При подсчете линия дает неожиданные результаты, мы должны проверить, если каждый текст коммунальных обработки понимает, что линия идет таким же путем. Обычно это сводится к двум вопросам:

1 файл) вопросы преобразования: что charactes(ы) используются в качестве EOL (конец линии ака символ новой строки, или разрыв строки)? Это может быть , или \р\н в зависимости от операционной системы.

2) Это самая последняя строка также заканчивается Эол? Если нет, то как обработка текста утилиты справиться с этим?

В этом случае второй вопрос ведет к объяснению.

При чем тут туалет -я графа?

Прямо из страницы:

-л-линии печати новой строки графы

Очевидно, в последней строке не учитывается, если оно произойдет, будет не заканчивается переводом строки, т. е. результат-то один меньше, чем реальное количество строк.

Какая команда grep производит?

команда grep завершается каждая выходная строка с новой строки. Я не нашел это в документации, только проверял.


Теперь мы можем сделать тест, чтобы объяснить поведение, описанное в вопросе:

  1. Давайте создадим тестовый файл с 3 линиями, но без завершающего символа новой строки

Эхо-СВ "первый\nsecond\nthird" > 3lines.txt

  1. Давайте проверим последний символ:

хвост -1 3lines.txt | ОД -с

Ок, нет '\п'.

  1. туалет -л < 3lines.txt

Выход: 2 (последняя строка не засчитывается, потому что последние строки отсутствует)

  1. Пройти все линии через grep

грэп . < 3lines.txt | туалет -л

Выход 3 (все линии засчитывается, потому что нет строки отсутствует)

  1. Отфильтровать только одну строку (это может быть любая линия)

команда grep -v сначала < 3lines.txt | туалет -л

Выход 2 (опять все линии засчитывается).

+413
Harley D 16 июн. 2017 г., 04:21:49

От iOS разработчик программы поддержки:

Если я зарегистрирован в качестве индивидуального в стандартной программе, могу ли я использовать чужую кредитную карту, чтобы купить программы?

Биллинговая информация, предоставленная для покупка должна точно соответствовать Программа сведения о регистрации. Если эта информация не соответствует зачисление будет отложено и вам попросят предоставить нотариально заверенное копию государственного документа идентификации.

Я хотел обратиться в службу поддержки и спроси у них, что делать дальше.

+401
wujek 14 янв. 2010 г., 20:38:29

Я уверен, что размер ноги-это комбинация генетики и гипертрофии от упражнения вы принимали участие.

Я согласен с принимая меньше калорий. Вы будете терять вес, но нет никакой гарантии, когда вес придет. Я хотел работать становится стройнее в целом с помощью физических упражнений и диеты, но в то же время научиться принимать свои ноги такими как они есть. Легче сказать, чем сделать я знаю.

+390
Richard Armendariz 26 нояб. 2011 г., 18:22:42

Какой самый простой и надежный способ определить базовые сетевые атрибуты биткоин? Под этим я подразумеваю (расчетная) общая сеть хеширования скорость, сложность, количество блоков решена, и т. д.

Я знаю, что есть тонна сайтов, которые могут дать мне это. Но я интересно, если есть несколько простых и формализованных способ, чтобы прочитать эти данные откуда-то, что не подлежит внезапно изменить их расположение (как на сайте). Также я не уверен, если бы меня в использовании программа для извлечения данных из него.

Моя цель-просто написать небольшой локальный сокет программы, которые могут сделать некоторые статистики и экстраполяции на основе текущей (и предыдущей, хранящихся локально) данных.

+347
Tayn Blacklin 21 апр. 2020 г., 20:58:27

То есть слишком много фруктов за один прием пищи. То есть слишком много фруктов за один день. 2-3 средних фруктов (яблоко оранжевый) - это рекомендуемый максимум.

Более Пристальный Взгляд Внутрь Здоровые Привычки Питания

Стремиться к сложные углеводы над простыми.

Если вы хотите топливо, днем тренировки, то есть миску овсяных хлопьев на завтрак.

+298
warribros 2 окт. 2022 г., 05:33:19

попробуйте установить libqt4 из центра программного обеспечения Ubuntu, вы должны искать "смотри технических документов" на самой низкой части программного обеспечения. также установите Либре CAD из своих хранилищ.

> $ судо дополнения кв-репозиторий PPA:Либре КАД-Дев/Либре КАД-ежедневно
> 
> Чтобы оставаться в курсе новейших сборки, просто введите "обновить Ubuntu по 
> Менеджер" или:
> 
> $ судо apt-получить обновление
> $ судо apt-получить обновление
+288
A NambiRajan 24 мар. 2014 г., 06:21:27

я запущено обновление Убунту с 11 до 12,4 и когда компьютер перезапущен логотип Убунту показал скорей, потом черный экран со значком мыши с кругом ждать, вращающиеся непрерывно. я пытаюсь загрузиться со старого Убунту 11.00 компакт-диска и то же самое происходит. любую комбинацию клавиш для загрузки в безопасном режиме или какие-либо предложения, пожалуйста ?

+233
shanonburke 17 апр. 2018 г., 20:52:00

Хотя вы не можете быть в состоянии синхронизировать нескольких iCloud заметки с других аккаунтов iCloud, вы все еще можете поделиться эти заметки непосредственно из интернета (или других устройств), так что они появляются непосредственно на ваших личных устройствах. Это позволит вам читать и редактировать заметки с синхронизацией их на свой счет.

Это очень полезно при использовании отдельных идентификаторов Apple.

в iCloud: поделиться заметки на iCloud.com

+171
CR1988 14 мар. 2011 г., 15:32:51

Я хотел убрать поддержку NTFS я установил через Tuxera NTFS для. Когда я проверил свою панель настроек, вариант, кажется, был серым. Как мне удалить его теперь?enter image description here

Я попытался отключить его, но все равно "удалить Tuxera NTFS С" был только серым.

Бег - в macOS 10.12

+110
independent 28 июл. 2018 г., 03:19:09

Что вы подразумеваете под гнома, авто запуск, скорее всего, на самом деле ГДМ (гном отображения диспетчера), который обеспечивает экрану входа в систему. Просто отключить службу, чтобы остановить его от автозагрузку. Арки использует systemd в, так что вы хотите сделать:

# systemctl отключить ГДМ

Перезагрузка и ГСД не запускается автоматически. Затем вы можете вручную запустить его, когда вы хотите с:

# systemctl начать ГДМ
+97
frankfzw 26 янв. 2014 г., 10:18:24

Показать вопросы с тегом